hjälp

3 dagar sedan någon skrev. Känns väldigt fel. Vad ska vi göra åt detta? Ta oss i kragen? Ja det tycker jag.
Idag så har det varit en bra dag. Det är helt amazing väder, studiebidraget kom idag och imorgon är det 1.a juni, DÅ ÄR DET SOMMAR HÖRRNI! Och det är bara 11 dagar kvar tills skolan slutar, och jag är fri! (Jojo, Cissi, jag vet att ni slutar den 4.e. Shut up). Nej hörrni, ut i solen kanske? Ja det tycker jag. RÄDDA BLOGGEN!

pusssssssssssssssssssssssss

MAARKUS.

EXAKT EN MÅNAD NU. Nej bilden är inte för stor.
.

Hejja, hejja, nu blir det nytt rekord!!

Det är inte helt fel att sluta vid elva en fredag!! Nu är det exakt två veckor kvar till sommarlovet! Det är inte mycket alls! Det är väl egentligen bara en vecka kvar med prov och redovisningar, sen sista veckan är det nog inget speciellt! Härligt!

Jusste, jag gjorde nyss en god gärning! Det var ett äldre par som stod vid campus så frågade de mig om vägen till stan. Jag kände mig strong att jag förklarade vägen så fantastiskt bra! Ja, inte för att det är den svåraste vägen direk, men ändå.. hehe

Jag känner att rubriken till detta inlägg inte riktigt hänger ihop med texten, men men..


Aktiva klubben

Operation Nödvändig Skoldag är inledd.Och avslutad, i stort sett. jag åkte dit 8.30, är hemma igen 9.30. YEAH! Världens längsta skoldag. Men på dessa 60 minuter har jag faktiskt fått nåt vettigt gjort. Jag har hämtat handduken som jag glömde på Lauras, och jag har även beställt tid för Massage (fick ett presentkort i julas, har inte hunnit använda det än) Vecka 23, tisdag, 11:00. Det blir en bra start på sommarlovet :) Håhåhå. Mina axlar är alltid spända, stela, gör ont, you name it. Jag skulle behöva nackmassage 24/7. Faaaan va det skulle kosta ._.

Ehm. Nu tänkte jag bege mig ner på stan igen och panta flaskorna. Det är stört mycket flaskor/burkar jag ska panta. Det kommer se ut som att jag är värsta läskdrickande datanörden(A PERFECT DESCRIPTION OF ME, WEHE!) fastän det inte ens är jag som druckit allt detdär. Jaja. CAREBOX. Jag får ihop pengar i alla fall som jag sen ska ge till Unicef AKA Gunnarfonden ^^ :D

Resterande av dagen är det tänkt att jag ska plugga (OKEJ, inte hela dagen... men många timmar) och det ser jag väll inte direkt fram emot. Men sen imorgon är det över. Woooooooooop woop! OCH DÅ HAR VI I STORT SETT SOMMARLOV!!!
Me want. Me have. Me buy. (inte för att detdär passade in där... menmen xD)

Smygreklam, HEHEHEHE: http://verkligeen.blogg.se
Okej, dethär var sista gången jag nämner min blogg i denhär bloggen. Not najs of me.



grönt ljus åt alla

jag vill till eskilstuna nu! inte sen! jag vill ha bra betyg nu! inte sen! jag vill ha sommarlov nu! inte sen! jag vill till P&L nu! inte sen! varför händer allt roligt sen?
oh eeeeeskiltuna var det, klänningar, skor? eller? eh jag gillar det. värt? a
eyyyyyy blå/vit prickigt med mina låga converse? jao låter underbart if you ask me
puss på jennifer som återupplivats från döden <3

hoho?

seriously, när ska bloggandan komma tillbaka?

Svart ram, puts väck!

Sådär, nu har jag tagit bort den sjukt fula feta svarta ramen som kom upp runt alla bilder.
Jag hoppas att alla andra också hatade den, annars kan jag sätta dit den igen om folk vill ha en ram^^

Weho!



VoiceOver

På min dator har jag en sjukt rolig funktion som heter VoiceOver.
Den går ut på att jag kan få en dataröst att läsa upp vad jag har skrivit på t.ex Word. Man kan bestämma röst själv, och även lägga in effekter som t.ex "spökröst" osv. Jag sitter och asgarvar. Den kan nämligen bara läsa upp engelska. Den läser altså det jag skriver på svenska med engelskt uttal, så typ "läser" blir "laeiisörrr". Man hör inte ett jävla piss vad den säger och det låter SÅ JÄVLA ROLIGT xD HAHAHA HAHAHA.

VoiceOver är bäst. Jag tror det är till för blinda personer egentligen. Jag tror inte att blinda personer i Sverige skulle ha så stor nytta av VoiceOver. Faktiskt.

<3

(jag kan tillägg att jag kommer skriva mer på min nya blogg än på denhär bloggen i framtiden... så alla vet :D)


Inte okej

För att skriva lite mer vardagliga saker, så tänkte jag börja med att säga att tisdagar allmänt suger. Idag sög.

Det började med att jag försov mig. Flög upp kl kvart i åtta, åt ett turbopiller och gjorde mig iordning på ca en halvtimme. När jag kom ut störtregnade det, och så fortsatte det HELA dagen. Blä. På första lektionen hade vi NP Uppsats på Spanska. Blä. Sen hade vi fysik där vi gjorde ingenting. Blä. Sen hade vi lunch där vi satt på Lauras och "pluggade" särmatte. Sen hade vi EU där vi fick information vi redan hört. Blä. Hela dagen har faktiskt varit rätt onödig, förutom själva spanskaprovet xD och så hade vi håltimme(från fysik-EU) i 2,5h för att vi VA TVUNGNA att gå på EU för dom skulle berätta SÅ VIKTIGT information. Nej. Nej nej nej.

Jaja. Nu ska jag försöka plugga matte på riktigt. Efter att jag haft detjär provet på fredag, är mitt skolår i princip slut :D så nu ska jag anstränga mig som fan! Sista provet. Ingen annat på hela veckan. I WILL MAKE IT! Det är skitsvårt :S men vi klarar det, allihopa, både SP och NV :) <3

NOW IT'S PLUGGTIME!

Det regnar ute :(

Jag har lagt upp inlägg på Verkligeen, men dom kommer inte upp :( boho
EDIT: Nu funkar det :D


Allt av vikt jag säger har jag stulit ur en bok

*Poke poke*
Uppdatera ffs xD bloggen är död ju :(

Jag tycker att alla ska lyssna på Hagnesta Hill, ett helt underbart album av Kent.
Kents bästa album, absolut.
Har du inte hört det, lyssna.
Har du redan hört det, lyssna igen.
Jag tvingar härmed alla att lyssna på det.
Alla ska. Alla. Även du :)



Kan du beskydda mig?

Jepp, jag har gått in i en ny Kentperiod <3
I love it, finns inte bättre musik <3


Mwep ._.

Måndag, bajsdag, särdag, whatever you call it. Den har iaf varit helt okej. Halvt okej. Gympa, köpa glass och matte. Sen sång och gitarr, det gick bra iaf :)
Jag fick G på spanskahörförståelsen. HAHAHHAHAHA. Sämst. Jaja. Så kan det gå.
Annars så blir jag allmänt deprimerad av vissa grejer. Kul. Men det tar jag icke upp här. Det är inte relevant :)

Jag avslutar med att lägga in en random bild för att liva upp stämningen lite:)



Popaganda ftw!


Balsammetoden - Here I Come!

I've got a mission.
Jag säger bara BALSAM-METODEN HERE I COME!
Jag är trött på att mitt hår inte gör som jag vill. Jag fick damp nyss och tvättade om håret för att få bort det klistriga, för det var uschusch. Nu sitter jag på lockig.se och kollar igenom olika produkter. "Sista-schampoo" har jag redan hittat, det fanns hemma. Så jag söker just nu efter tvättbalsam, vårdande balsam och stylingprodukter som är godkända. Jag har hittat några nu som jag ska införskaffa så snart som möjligt. Det lär gå åt så jäääävla mkt pengar. Men om mitt hår blir PERFECT av det så är det värt några hundra spänn :)

Jah. Så nu sitter jag här med blött hår. Jag såg nyss ut som en random turbansnubbe, jag tog en t-shirt och lindade runt istället för en handduk, ska tydligen va bättre. OCH JAG HAR INGET LOCKMOUSSE I, så om jag ser ut som helvete i håret imorgon vet ni varför :) bättre det än att håret känns som en klisterfabrik i alla fall.
Spännande. Har inte duschat utan att haft i mousse på några år nu. Jag exprimenterar. Mitt hår kanske blir ett burr? Det kanske blir platt och locklöst? Det kanske blir fult?
Vi får se. Annars finns det nåt som kallas plattång som kan rädda mig.

Jag har värsta förhoppningarna på dethär. Jag har nosat på denhär metoden i flera år nu, men inte orkat pröva(JAGÄRSÅDUMDUMDUMIHUVET) men nu är det dags. Ändan ur vagnen. Tjoho!


Blir det fest efteråt då eller?

Idag var jag på konfirmation. Det var Martin (Matilda) som konfirmerades! Å jag har ju sådan oerhörd tur, när vi stod utanför kyrkan så kommer Simon (min gamla konfirmationsledare/ präst) fram och pratar med mig! Jag försökte till en början gömma mig, det var verkligen ett "se mig inte, se mig inte, se mig inte.. nejmen HEJ!" ögonblick!

Sen skulle jag vilja efterlysa solen! Den är spårlöst försvunnen! Men den beräknas återfinnas inom de närmsta dagarna, förhoppningsvis!




Waste of time

Jag har fortfarande inte gjort något vettigt idag. Jag har käkat vattenmelon och crostinis med philadelphiaost på. OM NOM NOM. Och typ glott på TV. Så jävla waste of time. Det har slutat regna ute nu iaf, men det blåser SJUUUKT mycket. Jag lyckades även ha i för mkt av ett annat märke på lockmousset igår när jag tvättade håret, så nu finns det några enstaka hårda lockar i mitt hår xD mysko. Note to myself:

Man ska köpa Shockwaves lockmousse, inte Lóreals!

Remember that. Lóreals gör håret stelt och klibbigt. I alla fall mitt. Shockwaves gör det mindre lockigt, men det blir inte klibbish i alla fall. Äckel päckel.



En sak som gör mig glad inombords är att mitt i-landproblem denna vecka (idrottsdagen) är inställd, och att det nu endast är två veckor kvar tills sommarlovet. Två veckor. Det är ingenting! Sen har vi gått 1/3 av gymnasiet! WOOPWOOP! Känns great faktiskt. Jag ser fram emot massa grejer jag ska göra i sommar :D:D:D sommaren är min årstid. Jag är gjord för att leva i ett varmt klimat. Typ. Jag gillar värmen <3


Woop

REKLAM!
Heöhöehöehöehöe, nu har jag en egen blogg också :D den e ful och sär men det gör inget, och jag kommer inte lämna denhär bloggen bara för det utan kommer göra typ som linnea å ha två bloggar där jag skriver samma sak :D jag vet att det och jobbigt, särigt och allmänt onödigt, men jag ville ha en ._. håhå, så jag skapade en :D

Verkligeen heter den, skapades för några månader sen men kom aldrig igång, och jag hade tydligen namntorka när jag hittade på namnet också. Woho!

Allmänt onödig information, tjoho!


Dagens carebox!

Jahapp. Kul väder vi har. Hade förväntat mig lite sol denna wünderbara söndag, men icke. Gråa moln pryder vår himmel och regnet faller från skyn. Trevligt värre. Jag har absolut inget att göra. INGET. Kanske rita i min skapabok, då fördriver jag 5 minuter på ett effektivt vis. Resterande 11h av dagen går jag på sparlåga, glor på TV eller gör nåt annat ospännande.

Nu skulle vara den ideala tiden att fixa mina tänder, dom som jag köpte nytt lim till men aldrig har fixat än. Haha, jag vågar inte! Det kommer bli fel igen, och vips(!), där flög dom pengarna iväg liksom. Men jag vill fixa dem. Blupp.



Dagens carebox!


nu är dags

våran blogg är jobbig, så nu är det sagt förlåt

☮BKK

Jag där snart!!! JAG DÖR, JAG DÖR!!!
Det är nämligen så att jag är en simpel varelse med ett simepllt tänkande. Det finns bara tre saker jag säker på

  1. Stil, kläder, shoppping (jag är fullt medveten om att det inte syns på min klädsel, men jag tänker faktiskt på det)
  2. Killar (även detta är jag medveten om att jag inte visar, yes, folk tror jag e lebb)
  3. Mina betyg (detta borde alla veta så som jag brukar få ångest över hur sämst jag är på att plugga)

Men du är det så här att om jag träffar en snygg kille så börjar tänka på mitt utseende mer. Alltså vill jag shoppa som fan. Detta i sin tur leder till att jag inte kan koncentrera min på pluggandet.

Så då kan vi säga att det är kört i matte, fysik, svenska, spanska och samhälle tills jag tar första bästa tåg till sthlm för tile shopping.

FUCK I LÖÖÖÖÖV STRÄNGNÄS CITY!!!! Så jäkla stort urval på buiker!!!!!!! FUCK YES!

Lite insperation tills nästa lördag, för då drar jag till sthlm om jag inte hinner avlida. Bilderna hittade jag på wildfox bloggen ^^





Fan, fan, fan
Det knacka på dörren o jag har precis vaknat :S



PEACE OUT!

☮BKK


 

 






Som om jag föddes till den jag måste bli

Får lite dåligt samvete över att Jojo har skrivit fyra inlägg i rad nu, det är inte riktigt okej.
Idag har jag varit i Uppsala på konfirmation! Jag behöver inte dra hela historien om hur bra min släkt är och bla bla bla för det är inte särskilt intressant att läsa, så därför gör jag inte det. Jag har iallafall skrattat i princip hela dagen och haft en finfinfin kjol på mig.
IMORGON SKA JAG PLUGGA HELA DAGEN!!! Gud vad jag ser fram emot det.
Måndag - svenskan klar.
Tisdag - provvandring.
Onsdag -  fysikprov.
Torsdag - matteprov och nationella i spanska.
Fredag är hittils provfritt! Lovely vecka.
.
.
HIT SKA JAG I SOMMAR! Med två av mina favoritpersoner, wiho.

Hjärtattack

Jag var nyss farligt nära att dö i en hjärtattack.
Jag sitter och skriver min skapautvärdering, är precis klar och ska spara den, men när jag klickar på spara så laddar den i EVIGHETER och man kan inte klicka på nåt annat (min data brukar göra så när den laggar). Jag får grovpanik eftersom jag suttit och skrivit på den i evigheter, den va 1337 ord lång (ELIIIIT) och jag skulle gråta om jag var tvungen att skriva om den eftersom jag var väldigt nöjd med den.

När jag sitter i min stol utomhus, hyperventilerar och väntar på ett mirakel, så bestämmer sig en SJUKT stor humla för att den verkligen vill förvärra min tillvaro ännu mer, så det börjar flyga runt mig och brumma jättehögt. Jag reser mig upp och springer därifrån, men den följer efter mig så jag springer in inomhus och tror att faran är över. Men icke, humla flyger in genom altandörren och fortsätter att terrorisera mig inomhus och jag springer ut igen. Nu sitter humlan i mitt fönster och surar.



Min skapautvärdering klarade sig som tur var, datan laddade bara JÄÄÄÄÄÄVLIGT långsamt(i ca 10 minuter). Nu är den färdig och inskickad och jag är glad igen.
Nu ska jag släppa ut humlan eftersom den börjar få damp. Tjoho!


Tuppen vaknar!

Tjoho folks!
Uppe med tuppen :D (eller inte)!
Idag stod det på SMHI att det skulle regna. Ser jag nåt regnmoln? Nepp. FÖR DET ÄR INTE ETT ENDA MOLN PÅ DEN KLARBLÅA HIMLEN! UNDERBAAART!
Jag vill åka ner och träffa Amanda och Cissi, men eftersom det kommer fönsterputsare idag så måste jag vara hemma och vänta på dem -.- och jag vet heller inte vilken tid dom kommer... tänk om jag måste sitta och ruttna hela dagen? :S Blöö. Jag får sätta mig ute i solen och chilla istället. Eller nåt.



Amanda och en uniform :D

Jepp, kort morgoninlägg. Plupp på er <3


Kaktusen och jag

I brist på normala ämnen att skriva om så tänkte jag berätta om världens finaste kaktus.

Min fina kaktus har jag odlat helt själv. När jag köpte honom var han bara ett litet litet frö. Jag sådde ca 59257 frön, men det var bara två som klarade sig, nämligen min kaktus och en som jag gav till Annbanann för några år sedan. Iaf, min kaktus är liten och tjock. Höhö. Den har rätt många år på nacken nu. Den är förmodligen kanske hälften så gammal som mig. Och ändå är den bara ca 6 cm hög. Kortis. Jag gillar min kaktus. Den är fin och står ut med att jag suger på att vattna den. Alla mina andra växter blir ledsna och dör, men min kaktus står kvar <3 håhå. Vi passar bra ihop, kaktusen och jag.



(Annars har dagen varit asslapp. Matte först och sedan engelska där vi kollade på skitskum film och sen slutade vi! Gick och picknickade med Ann, Janina, Linnea och Cissi i Ugglans Park och hade det mysigt. Rawr!)


Some kind of nature

Idag har varit skönt, men STÖRT varmt. Jag smälte.
Jag har skrivit en insändare om vägsalt.
Jag lyssnar på random übergammal musik och gillar det.
Mina naglar är färglösa och mitt hår är lockigt.
Kan det bli bättre?



Jag borde skriva en Skapautvärdering nu.
Men den kan jag lika gära skriva imorgon.
Men jag kan börja idag typ.... eller nåt. Håhå.
Imorgon är det fredag <3<3<3


rawr

tänkte ta bort ebert´s Facebook idag haha och innan man tar bort den kommer detta upp
fast jag tror ändå frida kommer sakna honom mest ://

hur fan?

oh jag har kommit på nollpunkten, du har 205 fiskespön måste du sälja 5065 för att få vinst.. greeeat
nu är snart denna vecka över och jag har gjort alla prov jag belönar mig därför med ett par nya converse låga och vita mums på det!
hejhejhej då

danborsti

Igår fick jag lära mig två stycken nya ord. På norrländska.
Danborsti = där borta.
I jonst = igår.

Och nej, jag hittar inte på! tro det eller ej, men det ÄR faktiskt svenska!

Idag på bussen blev jag glad. Typ kände hur hela hjärtat bara myste. Det satte sig en kille framför mig som var väldigt lik Salem Al Fakir. Han hade samma gulliga krulliga hår ni vet? Och så satt han och nynnade jättefint. Varför finns det inte fler folk som sitter på bussar med krulligt hår och nynnar? Världen skulle bli så fin!

Jag giver er min allra ömmaste kyss!


Stoppa vägsaltningen!

Jag sitter här och försöker komma på nåt vettigt att skriva en insändare om... vi ska göra det imorgon på SV och jag vill vara förberedd eftersom jag är så grymt ineffektiv när det gäller skrivande på lektioner xD jag har tänkte ne stund nu, och jag känner att "Stoppa vägsaltningen!" är mitt kall. Perfa. Miljökämpen Jojo. Jag ska skriva en insändare om vägsalt. Sounds great. Not. Men vafan... det duger :D Håhå.

Annars så har jag inte så mkt att göra. Ska beställa en klänning från nätet (HÅHÅHÅH) som jag hoppas kommer hit innan skolavslutningen, annars tar jag nåt annat :) Najs. Men den ska jag ha :) RAWR! Edit: NOT, för den är inte värd så jävla mkt som den kostade! Och imorgon har jag sovmorgon och det känns great, jag blir alltid så glad på onsdagskvällarna när jag kommer på att jag kan stiga upp en timme senare. Yay! Hihi.

NUUUU ska jag göra nåt. Jag har ritat i min skapabok varje dag dom senaste dagarna nu :D känner mig rätt duktig, med tanke på hur länge jag annars brukar komma ihåg att göra det (dvs en dag). Men nu säger jag hejs svejs för ikväll! Pöss <3



Min fläkt

Hej alla människor :D
Idag har detvvarit en väldigt bra dag på nåt vis. Fysikprovet gick så jävla bra! (läs: det var tre frågor o.O, jojo höftar till med nån formel och otroligt nog var det rätt) Nej, men jag är happy, så jag va bara tvungen att skriva det FÖR JAG E SÅ JÄVLA GLAD :D YAY! Nu är det bara spanskan imorgon kvar, sen är the week of BAJS over. Yaaaay! Woopwoop!

Just nu sitter jag och käkar nötter(öh?) och har precis nyinvigt min fläkt. Min fläkt äger. Den är ovärdelig när det är varmt, och just nu är det JÄVLIGT varmt. Jag trodde jag skulle dö hela dagen. Det är sjukt varmt. I love it. Sommaren är här <3

My wonderful fan(hahaha):



Hehe, så jävla ospännande xD

Hare gött<3



när du får spring i dina ben och jordens dragningskraft är klen när du är i luften kom ihåg mig då

Måste bara skriva ett sms jag fick av Annica imorse innan matteprovet:
.
Det var en gång en flicka som hade fått hicka!
Hon började frysa och nysa!
Detta var för flickan mycket skumt, varför betedde sig hennes kropp så dumt?
Plötsligt slog det flickan att detta var ju Dagen med stort d, det är ju idag hon ska ha nationella i matte b!
Flickan kände sig rädd, exposed och naken, och plötsligt lite kall om baken.
Det var ju idag hon skulle räkna ut en massa krumelurer som inte går att förstå!
Flickan tänkte "kära nån, vad har jag gett mig in på?! Åh jag skulle gjort som min vän Annica, valt det där fantastiska programmet samhälle, då hade jag funderat på världens alla brister iställä!"
Nå, gjort är gjort, lort är lort.
Mitt i allt detta gråt och förtvivlan kom en fe, som äntligen fick Linnea att le!
Fen sade "att du tar dig igenom detta är ju klart, för du är häpnadsväckande smart! Du måste bara våga tro på dig själv, snälla hopp inte i någon älv!"
Eftersom att jag är fe så vet jag att du kommer att klara detta galant, och du är inte så nonchalant!
Du är bäst, lika mycket som en häst!
Förresten, den där Annica har ljugit för dig om att hon harhäst, bara för att du ska pli impressed!
Nu önskar jag dig all lycka till, hoppas att du inte någon wanna kill!
Detta kommer att gå bra, därför säger jag redan HURRA!
.
Provet gick bra. Det var nog mycket smsets förtjänst faktiskt.

Before I Fall to Pieces

Nationella i matte B idag gjorde att det nu bara är nio prov to go innan sommaren! Nio prov på tre veckor, det ska vi ju klara.
För tillfället sitter jag i solen och lyssnar på min underbara sommarlista. Om tre veckor och tre dagar är det ju faktiskt sommarlov.
Imorgon ska jag och Linnea bryta oss in i en viss persons lägenhet och baka kakor och sen dra med honom ut på picknick, eftersom ingen annan verkar gilla den iden.
.
SOMMARBILDER HERE WE GO

.

.

.

.

.

.

.
.


skola 11 timmar HIGH FIVE PÅ DEN

Jag är fel på skånska..
ja zeus har en tre-udd
ja erik thomsson var han som skrev om roms fall
ja Grekland har dålig jordbruksmark.
hallå det vet ju alla...........

Makaronisallad

Denna vecka är den veckan med mest prov i som jag har haft på väldigt, väldigt länge! Eller, tror inte att jag har haft så många prov på en vecka förut! Ett prov varje dag! Idag avklarades muntligt nationella i engelskan vilket gick rätt bra! Sedan väntar två matte prov, engelska, och så svenska denna vecka! Looovely, typ! Nja, inte precis!
Idag fick jag även se grannens barnbarn "live" för första gången, trillingar på bara några få månader, så sjukt söta!

Nu ska jag väl återgå till bibelns alla visdomsord! Ja, vi har ett fantastiskt prov om bibeln imorgon..


PQ-formen

Min kväll kommer bestå till största del av umgänge med matematikboken. Möjligtvis lite hallongrottor också.
DET ÄR SÅ SJUKT HÄRLIGT VÄDER UTE!! Man blir ju lycklig av att bara titta ut genom fönstret.
Nu ska jag slå upp boken och peppa inför provet imorgon! LYCKA TILL MIG SJÄLV!
.
Bild.

Atriumhus

Amagad.
EUprovet is over! Och jag tror det gick rätt bra :D WEEEI!!! Nu är den skiten över. Woopwoop! Nu är det vara 3 prov kvar :P
Dagen i sig har varit rätt bra. Underbart väder <3 och sen så åt vi glass på Lauras, lunch på Blå Koppen, pluggade, hade matte och sen provet typ. Så, helt okej dag :) najsigt. Imorgon är det MatteB nationella... och jag vet inte riktigt hur det kommer gå. kan gå bra, kan gå dåligt, men jag ska i varje fall plugga lite matte ikväll så jag inte är helt lost imorgon.

En grej som va lite WTF? var att när jag cyklade hem och cyklade in på våran grusgång och satte ner foten, så var jag SÅHÄR nära att trampa på en brun råtta O.o Den va typ 1m ifrån min cykel. Den sprang iväg över vägen, och den haltade :( men det va första gången jag såg en vildråtta(hehe). Jag gillar djurinvasionen som drabbat min tillvaro på senaste tiden. Det är mysigt. Hihi. Jag gillar djur. Det känns fint när man ser älgar, harar osv på sin tomt. Mys.

NU, mina vänner(och familj, eheheheh), så ska jag... eh. Vet inte. Göra nåt. Typ. RITA I SKAPABOKEN! Jag måste göra det varje dag nu känner jag. Annars kommer jag få rita för 4 veckor igen = jobbigt.
Peace!


heheheheheh

Nu är det ballar av stål, och jag kommer att dö av skratt, som vanligt!


take me back

jag har kommit på en sak att jag blir inte lyckligare av att kunna allt, jag blir inte lyckligare av att plugga det här. jag blir ju mer olycklig när man börjar förstå att man verkligen inte kan. som jag försökte
jennifer hellberg är bäst det har jag också kommit på denna sär-söndag
nu off du work, ska blir skönt och slippa tänka på den här skiten ett tag (:

Band of Horses

Istället för att plugga matte sitter jag och ritar hjärtan på P&L-affishen. Och ja, det är hjärtan och inget annat.
.

Busted

Hej pappa, jag vet att du läser denhär bloggen ;)

I alla fall. Nu är jag tillbaka från Torö och mitt hår luktar rök eftersom dom alltid eldar där. Haha. Jag ser inte direkt fram emot idag, eftersom idag kommer bestå av endast pluggande. Europakunskap. Rawr.
För att alla ska förstå hur olidlig denna vecka är för mig, så ska jag nu sätta upp ett litet schema:

Måndag:
Europakunskapsprov (JÄTTESTORT prov ._.)
Tisdag: Nationella prov i Matte B
Onsdag: Fysikprov på något vi knappt gått igenom (elektronik)
Torsdag: Nationella prov i Spanska, hörförståelse.
Fredag: Inget hittills.

Jag är rätt stressad, men jag tror det kan gå bra ändå. Bara jag inte panikar, för då går det bara dåligt, hehe. Det är iaf inte flera prov på samma dag. Bara samma vecka, och det är bara 3 veckor kvar nu. Sen får jag SOMMARLOV. Så nu ska man lägga i högsta växeln. Sen tar min bensin slut :)

Jahapp. Då kanske man ska sätta igång då... kul. Jättekul. Eller inte. Unde tiden jag pluggar kan jag måla naglarna blåa, så jag blir glad :D hihi



eko

Jag och Jude Law skulle vara det perfekta paret, inte sant? synd att han inte fattar det bara. Gorgeus<3

865

Idag har jag legat ute i solen i fem timmar och pluggat matte och lyssnat på musik. Jag har röda ränder på ryggen. Men vadå, det är överskattat att vara brun.
Sen promenerade vi i Strängnäs och åt Nogger Mint, som visst är god. Det var inte ens kallt fast klockan var halv tio.
.
.
Eftersom jag inte har några bilder på den här datorn får det bli en bild på denna underbara man, men det skadar ju inte!

25 grader celsius

Sol och 25 grader varmt, JA TACK!
Plugga hela dagen, NEJ TACK!


Blöööh. Det känns jävligt waste att jag måste plugga röven av mig på årets hittills varmaste dag. Jag helt enkelt bara MÅSTE vara utomhus idag. Men jag MÅSTE plugga idag, annars är jag körd som fan :( Kanske kan ta med boken ut? :D
Det gör jag nog ^___^



*hopp hopp*

NJUT ALLIHOPA, NJUUUUUUUUT AV DEN VARMA LUFTEN <3
WEEEEEIIII!!!


Fläkt från Claes Ohlson, endast 10 spänn.

Random bild från P&L förra året. Cissi är sötipöt som vanligt med sin minifläkt från Claes Ohlson runt halsen, och jag ser ut som en gammal tant med rynkor som kommit fel :D håhåhåh <3 min minifläkt gick sönder på en gång, damn :( </3

TAGGATAGGATAGGATAGGATAGGATAGGATAGGATAGGA!
JAG VILL HA SOMMARLOV OCH FESTIVAL NUNUNUNUNU!
FY FAN VA JAG LÄNGTAR. BLUBB BLUBB BLUBB *drunknar i längtan*



Japp. Sådär blir man när klockan är spöktimmen. Obsessed by a ghost named Gunnar (also known as Hannas kanin :D <3) Det var mysigt igår hos Hanna med alla, det glömde jag skriva tidigare idag pga mitt utbrott. Men nu vet ni. Det var wünderbar, weeei <3 inte ofta man lyckas vara uppe till 4... bara ibland ;) TACK MÄNNISKOR <3

BTW så har jag stött på många djur med müsiga namn på sistone... Eller näh, två, men det är många säger vi. Först Hannas urgulliga kanin Gunnar, och sen så kom det nyss hem en hund till oss som hette Ralf. Haha. I like it <3
Peace <3


ny vänskap

oh igår var underbart att dricka te fyra på morgonen med människor man gillar är nog det bästa som finns
jo tidigt åkte jag hem, men väl hemma fick jag åka igen till stockholm, är där varje helg just nu. fick världens bästa latte och en vattenpistol det är trevligt, en säng och tv kan också vara på ingång snart är man 17 då får man presenter
att plugga går helt okej, rom kommer bli en utmaning men fan vad nice och klara den. jag vill och jag kan.
nu ska glo vidare, msn är drygt. funderar på att ta bort den känns bara onödigt
great hugs from me

Huvudstaden

Dagen spenderades i Stockholm med mamma! Väldigt mysigt! Det blev många skoaffärer till en början, och sedan även väldigt många andra affärer! Blev mycket shopping, kul kul! Blev lite smått jobbigt när vi skulle ta tåget hem bara. De var tvugna att byta lok på tåget, efter ett tag kom de på att det skulle ta ganska lång tid så de hänvisade till ett annat tåg som skulle åka samma väg. Vi var då tvugna att springa till det tåget som låg en bit bort! Så ca. 10 personer sprang i en klunga och vi kämpade oss alla till det andra tåget. Så vi sprang genom tågstationen, upp och ner för trappor. Jaa, lite små komiskt faktiskt!




Macaroon

Åh, jag åt nyss en såndär kaka och den va SÅ JÄVLA GOD .____________.

Dom heter typ macaroon lr nåt tror jag... jag är förmodligen den sista i världen som äter en sån :(
Men dom ser ut såhär:



HELVETE va god den var :( WÄÄÄÄÄÄÄÄÄH ME WANT MORE!
ÄT SÅNA! ÄTÄTÄTÄTÄTÄT!


Jag önskar jag var där nu

Idag har jag inte pluggat lika mycket som jag egentligen skulle behövt. Inte på långa vägar. Men jag kände att jag absolut inte kunde koncentrera mig. Inte alls.
Jag har gjort svenskan och ritat i skapaboken iaf. Woop. Alltid nåt liksom... men stressen kommer snart.

Annars så har jag mest lyssnat på allmänt brutal musik idag. Great. Me like. Imorgon ska jag till farmor och farfar, OH SHIT JAG MÅSTE RINGA OCH SÄGA GRATTIS TILL FARMOR!!!!

NU RINGER JAG! PUSS <3




Det är långt mellan Flen och Paris

Jag har köpt världens finaste tröja. Men hittar tyvärr ingen bild på den så att ni kan få se ett bevis. Vad ska alla treplusfyraflickor göra imorgon förresten?
.
FARFAR+KUSINER+SOMMAR+GRILLAD MAT+POOL+SOL=AWESOME
.

Psykbryt

Jag fick nyss ett random psykbryt. Vardagen, ni vet. Kuligt.
Idag ska jag gräva ner mig i en jävla bokpool. Fylld med skolböcker. Matteeuropakunskapfysiksvenskaskapa.Jag håller på att dö av tristess och aggressioner.
Jag lyckades btw vika en stiftpenna på mitten. Nu är den fin och böjd i mer än 90 grader. Sorry guys, den går inte att skriva med längre. Tyvärr. Min kära penna(som jag hederligt stulit från min brors rum).

Jag kände nu att jag behövde en litenliten paus på kanske 3 veckor. Nja, allvaligt så tänker jag lugna ner mig ett tag nu. Fick en liten adrenalinkick där (därav pennan och den söndriga pärmen...)

Nu ska jag kanske rita i skapaboken :) yay. Bättre än EU iaf. Fy fan.


hm

Har kissie lagt ner sin blogg tror ni? Det går i alla fall inte att gå in på den.


Ansgar och Evelyne

Måste bara tillägga att jag har helt fastnat i den här låten. Jag fattar inte varför jag inte har lyssnat på den förut. Hela The Hjärta and Smärta EP är sjukt bra, och det upptäckte jag först idag. Så, nu vet ni.
.

älskling det är livet, som leker, det leker med oss nu

Kissie är med på Bella&Tyra show. Hon sitter och snurrar i stolen och säger emot allt de andra säger, det är lite roligt faktiskt.
.
.
Imorgon åker jag till Stockholm! Om det regnar blir jag arg.
.

Cigg cigg, mitt hår luktar cigg

Jag som alltid säger att jag ska göra saker man som aldrig gör nåt.  Jag har precis gjort nåt, så nu ska jag sluta tänka för inget bra kan komma från att tänka för långt.
Bild från tumblr. Texten är typ "story of my fucking life".



Men gjort är gjort. Antingen blir han glad eller så bryr han sig inte alls. Han kanske inte ens ser.
Men jag är ju iaf söt, så han blir väl lite glad, de e ju inte så att han inte försökt. Så nu försöker jag.

Peace Out Bitches




Fail Hail

Failade big time idag!!! Tänkte plugga och ta en varm kopp te. Så jag fixade lite te medan jag lyssna på radio via min mobil. Eftersom jag inte hade några fickor satte jag mobilen i bhn. När jag sen lutade mig över bordet för att ställa ner koppen så "plopp" sjönk min mobil till botten av koppen! Härligt!!! jag som precis fått tillbaka den ifrån Expert!!!


I LÖÖÖÖÖÖÖV IT!
Men eftersom min härliga dag inte kan bli värre än detta så ska jag göra något helt utanför min karaktär. Planen innehåller en viss kille i trean och en viss hemsida vid namn Facebook.

Pöss!





knorr knorr

(det här är endast för linda! ingen fattar, förutom linda!)

Gårdagen var great, förutom så innihelvetes kalla fötter! Jag och my lover Rebbecca kilade till Nor och tänkte kolla på när KungLinda spelade match, de vann!! Eftersom att jag och Rebecca var där ungefär i två timmar innan allt började, så åkte vi hem till Sanna och kollade i skolkatalogen. V.E <3 A.P<3 haha. Och Rebeccas mage pratade massor med oss, det var läskigt.
När vi satt och kollade på matchen så blev vädret som en äcklig november dag, vilket leder till att man inte har någon röst idag...kul!
nuuuu ska jag äta frukost!
(är det normalt att vakna självmant halv 9 när man är ledig? nej.)

Hulabandulabajskorv

Tjoho!

Annbanann är här. Vi har varit ute å sprungit. Som små björnar i skogen :D
Nu leker vi i Photobooth :D:D:D
Tha result:







We are beautiful ppl :D

lol

och



RÖJ.

TJUGO GRADER. TJUGO PLUSGRADER.

.

.


Skogsmuppen

Ojojoj, såg i utkastet att någon påbörjat en diss mot mitt kexchokladinlägg.... lååågt, mycket lååågt :P <3

EHM. Annars har denna tisdag varit rätt bra. Bättre än en vanligt tisdag typ. Iofs, förmiddan sög rätt hårt. Spanska och fysik. Rawr. Sen försvann alla och skulle öva inför EUn eller stack hem, så då gjorde jag också det xD kom tillbaka vid halv 3 för att gå på EUn, det va redovisningar :D NI VA ÄGIGA ALLIHOPA :D <3
Efter skolan beslöt jag mig för att ta en sväng hem till Annbanann. Där gick tiden jäääävligt fort, poff pang så var klockan 20:30 och jag cyklade till skolan för att hämta svenskaboken men det va låst :( boho.

Hemma hos Ann planerade vi våra liv, och vi har värsta planen som jag älskar. Den är hemlig. Höhö. Not. Jag kommer bara inte på ett bra sätt att skriva ner den på typ... :( men den är sjukt bra. Enligt oss. Yay! I feel it. JAG VILL BLI MYNDIG OCH SLUTA GYMNASIET OCH ÅKA IVÄÄÄÄÄÄÄG! <3 jagvilljagvilljagvilljagvilljagvilljagvilljagvilljagvill. JAG VILL. NU. Nunununununununununu ._. blupp.

Eöhm. Sen så lärde Ann mig hur man gör fiskbensfläta, yay! Jag va värsta pro redan från början (eh he he eeeeeh). Imorgon ska jag attackera någon och göra en fiskbensfläta. For sure. Håhåhåhå. Hå.



I love to be with you :D you make me happy for real :D:D:D:D <333

NU SKA JAG VARA DUKTIG OCH LÄSA EUROPAKUNSKAP. (läs: göra ingenting :D)



Killen med stråhatten, han som satte spår

En härlig Jojo våldgästade mig idag igen. Det blev litte solande på taket, pepptalk om framtiden, nutiden, mod och sommar. Vi kom fram till att vi inte är menade till att leva Svensson livet.  Haven't been there, won't do that!
Vi kom också fram till att Jojos mamma är cool och att jag ska göra som henne och bjuda in mig själv hos en viss kille och dricka upp hans te. Vem vet, det kanske kan vara något av det bästa som hänt mig...

 

Vi vill samma sak jag och Jojo (om vi bortser från att hon inte vill äta kexchoklad och jag vill). Vi vill bara strunta i allt och göra det vi vill. Men så funkar inte livet.

Jojo flätade mitt hår idag! Meeeheee she's a naturall braider!!! Haha, det blev så jäkla snyggt när hon gjorde det på mig! Har inge bild just nu, men jag kan lägga upp bilder andra saker som inspererar. 'Bilden är från wildfox

 

PEACE OUT BITCHES!










Another Sunny Day

[DJUP TEXT OM SOMMAR]
.
.

I close my eyes, what a beautiful sight!

Hej vänner! Idag är det fint väder, jag gillar fint väder, och jag gillar Maria Montazami, jätte jätte jätte mycket. Idag ska jag vara i skolan, sen ska jag baka tårta. Tårta är sjukt gott. Vet ni vad jag gillar mer? Jason Mraz, och sommar, och lite till.
Nu ska jag ta på mig mina skor och dansa till bussen. Idag är en bra dag, imorgon kommer det bli en dålig dag.
PUSSPÅER!





Den allmäna kexchoklad-dissen :)

En grej som de flesta tycker jag är rätt konstig för, är att jag avskyr en viss sorts godis, nämligen kombon

KEX+CHOKLAD

I detta svennebananland mer känt som Go å glá, Kexchoklá.
Nej.
Den är inte alls go å glá. Den är ond. Jag förstår inte vad folk tycker är så fabulöst gott med blandningen kex+choklad. Seriöst. Det är torrt. Fnasigt. Klibbigt. Samma konstitens som om man skulle ta crepépapper, varva det med lera och sedan hugga in på det. Om nom nom. Wünderbar.
Ne, jag ser verkligen inte det positiva i det. Man bli törstig, klibbig, torr i munnen, överväldigas av random chokladsmak. Rentav en jävligt torr kombo. Det måste liksom vara nåt klet med om man ska ha med kex i godis. Annars blir det som att äta wellpapp. Fast om ni gillar wellpapp ska jag inte klandra er. Smaken är som baken.












Jah.... diggar min bild där x)

Andra random saker jag inte gillar är:

- Snickers (uuuäh, jordnötter+kola </3)
- Jordnötter i allmänhet (förutom chilinötter, hihihih)
- Ljudet av när folk borstar tänderna (rasp,rasp,rasp)
- Smaskande (uschuschUSCH)
- För mycket glasyr/frosting (endast ickypicky)
- Blodstopp i armen (obehagligt)
- Folk som glor ögonen ur sig av olika anledningar
- Att vakna tidigt en helgmorgon. Fy fan alltså.

Haha. Jag har tråkigt. Detta inträffar när jag har tråkigt. Kanske borde sova snart. Typ nu. Så att jag är beredd på SpNP Hörförståelse imorgon. Vilket skämt. HÅHÅHHÅHÅHÅ. Jag garvar ihjäl mig. Nu ska jag sova. Peace out <3

OCH SNÄLLA, KAN INTE NÅGON TA BORT DEN FULA SVARTA RAMEN SOM KOMMER UPP RUNT VARENDA FOTO SOM MAN LÄGGER UPP? Den är ful. Den stör mig :(












Latmasken

SÅKLART har jag fortfarande inte laddat in några foton. Yay på mig :) men jag lever. Jag har målat naglarna blå. Det är en rosa sten på alla naglarna. Fan va fult, haha xD
Men imorgon, då jävlar börjar allvaret.... tills dess så får ni ta del av en hederligt stulen bild från jennifer :D håhåh <3



Sen så hänvisar jag såklart till alla vackra foton på Facebook :)
NUUUU ska jag fixa massa grejer. Tagga galet för skolan imorgon. Eller inte. Inte alls faktiskt. men det går som det går. Peace!


Damn

Dom hade inte min storlek så jag får klara mig ett tag till utan klackar :(

 

 

 

 

 

 

 

 


Gief me your monääää

Funderar på att ta mig till Jojo's place, haha, men jag vet inte om kvinnan vill ha mig där T__T Hon vill nog ha sina maltesers själv... :(

Iaf hade jag de trevligt igår, jag o Jannis promenerade i säkert 2 timmar i det kalla vädret. Men de var trevligt iaf. 



Iaf så finns det massvis med skit att fixa idag. Men det finns en grej jag behöver hjälp med!!!!! Weeeheeeee!
Okej, rösta på snyggaste skon!!! Jag vet att ingen kommer rösta för ni tycker säkert alla e fula, men de skiter jag i, kan ju iaf försöka få er att rösta!

 

Just nu lutar det emot nummer 3, den i mitten :)
Men men.... det slutar nog med inga skor alls....

PEACE OUT BITCHES!









Maltesers

Tjohopp, storbloggarN IS BACK :P
Veckan i Grekland var wünderbar med massa fina människor, vackert väder och gamla stenar. I kampen Delfi VS Athen vinner Delfi med hästlängder. Men i det stora hela ägde resan. Jag vill till Berlin nu, big time :D jag ska ladda in kort sen, så jag berättar mer om själva resan då, men om nu är fabulöst otåliga kan ni gå in på andras bloggar, alt. faceboken för att glo på lite spännande bilder :P fast nästan ingen har orkat ladda in nåt är, så det är bättre att kolla ikväll nån gång ^^

Idag har hittills varit strange. Jag vaknade självmant kl 9 (!!!!!) och var helt ensam i huset :( boho. Jag har inte hunnit med så mycket på dessa 3,5h, så just nu sitter jag och min älg och käkar ett BIG PACK med Maltesers som jag köpte på Taxfree. Malteser är den enda kombon kex+choklad som är god. Allt annat är skitäckligt.
Fast vi kanske egentligen skulle käkat Greker istället. Höhö.



OM NOM NOM NOM NOM säger älgen.

Nu ska jag äta.... wait for it.... LASAGNE! See ya later ;D <3


öfldsgfgbf

VARFÖR ÄNDRAR ALLA KATEGORIERNA?!?!?!?!?!??!?!?!?!?!?!?!?!?!

Truly you.

Den här låten borde alla lyssna på.
.
Imorgon är min plan att inte sätta foten utanför dörren. Gud så skönt.

Bans of Horses

Idag har jag:
- Stått ute i regnet och tittat på montessoribarn som spelade gitarr och slog på trummor.
- Bakat kakor hos Jonatan! (lögn, vi köpte sån där bakmix som man sedan blandar med margarin)
- Lyssnat på Tjejmaffian som sjöng "Kom Ihåg Mig Då", sjukt bra låt.
- Gått (kall) kvällspromenad vid vattnet.
.
Måste bara tillägga hur irriterande det är när folk skriver fel på "de" och "dem". Så himla svårt är det inte.
.

she will be loved

satsa på bättre uppdatering kanske? fast...vem bryr sig egentligen, vi har ju typ vaddå? åtta läsare?
Varför skriver man blogg egentligen? Snacka om slöseri med tid. Visst jag förstår storbloggarna som Kenza, Blondinbella och de där som försörjer sig på att (underligt nog) skriva "hej bloggen! Idag har jag varit med min bästa kompis petra och vi gick och shoppade för 15000, och sen gick vi och lunchade på stan". Jag skäms över att jag läser sånt crap. Varför bryr man sig egentligen? varför? VARFÖR?! Det här med bloggeri är wierd.
"Hej jag är snorrik för att jag skriver om vad jag har på mig och vad jag har ätit till lunch.
Ja, det är konstigt.
Och här sitter jag och bloggar om hur konstigt det är att blogga, det är ännu konstigare. Och jag känner att jag blir bara mer och mer irriterad på mig själv ju mer tiden går, så därför tänker jag lämna ämnet.
Idag har jag solat, gått upp för ett berg, ätit korv, blivit sjuk, sovit, blivit lite friskare, ätit choklad, ätit kött, kollat på jakten på julia, blivit ytterligare lite kär i måns, och ja, det var väl det. "VEM FAN BRYR SIG??!?!?!?!!?!?!" tänker ni, ja det är en fråga som aldrig kommer att få ett konkret svar.
puss på er!


Kultur10

Snart ska jag möta Carolina och Jimmy på stan. Sen ska vi titta när Carolina sjunger med tjejmaffian i thomas aulan! Det ska bli roligt att höra henne sjunga! Synd bara att vädret inte är så trevligt! Men, men..

Just nu hör jag att några från Så ska det låta sjunger "Jag vill vara din Margareta". Haha, Jag kommer ihåg när jag var mindre och stod med några kompisar framför tvn och tittade och dansade precis som de gjorde i filmen Eva och Adam, till den låten. Haha, vi tyckte dem var så coola! :)




Country Roads

Måste ju bara skryta lite med att berätta att jag sprang/joggade ungefär 3-4 km idag! Frivilligt. Okej, jag kanske tog några pauser ibland, men bara några. Känner mig cool! När jag kom hem firades detta med en kopp te, räkmacka och grannens friends-box. Mys!

Imorgon är det orientering, känns ju sådär. Men vi kanske ska göra som gympaläraren sa "ta med er en korg med bullar så går det bra" eller ja, någonting sådant sade han!

Det är inte långt kvar till sommarlovet nu!! Känns inte riktigt som att man har gått på gymnasiet i ett år! Men samtidigt känns det som att det var länge sen man gick i nian!

Som avslutning på detta fantastiska inlägg vill jag bara säga: Lengräddad (jag kommer inte ihåg vad det betyder, men i en tidning som jag läste för ett tag sen så frågades ett antal personer vad deras favorit ord var. Varpå en man svarade lengräddad. Okej, det var kul när jag läste det!! ) ;)



Echo and the bunnymen.

Men dom här tre böckerna ska jag spendera kvällen.
.
.
Ser mest fram emot den sista. Fysik A i mitt hjärta.
.

filååt

yo!
Jag är en usel bloggare, I know. Men sicken tur då att det finns så många andra fina människor här som bloggar så flitigt. Fast, det märks att Jojo är i Grekland, bloggarn herself. Igår hade jag, som er andra, engelska nationella, och det var SVÅRT! Varför ska de alltid göra texterna sjukt svåra, så att man förstår cirka en femtedel av det man läser? Dumt gjort.
Imorgon ska jag ha prov i spanska, och det, mina vänner, är självmord.
Nu ska jag vidare, får se om jag överlever morgondagen. Om inte, så var det i alla fall kul att lära känna er.

Good News

Äntligen har jag fått tllbaka min mobil! Tydlgen hade den varit inne där ett tag, men inget hade svarat när de ringt....
Men nu är jag glad. Haha. Bjuder på en lten bld oxo. Detta var precs innan Kent 26 Februari.



Nästa problem är att det bara är runt en månad kvar tll sommarlovet och varken jag eller Janina har klarat av allt det som vi vll innan sommarlovets början. Damn!

Sedan behöver jag ett par jäklgt snygga klackar. Fyfan vad jag skulle behöva det...  FUFUFUFUUFUFUFUFUF!











Flätor

Ville bara säga att det är sjukt snyggt med flätor. Satan att mitt hår ska vara så kort....







Jag fick hur som helst tag på nyckeln.

Jag har lite dåligt samvete över att det uppenbarligen bara är Jojo som skriver på denna blogg så därför tänkte jag berätta att vi har engelska för tillfället och sedan ska vi hem till Båtsman och Skrållan och äta tårta. Det ska bli jättemysigt tror jag :)
Ann fällde mig idag. Så att jag ramlada. På knänen. Och tårna. TACK ANN.


WOOOOOOP WOOP!

ZOMG SNART ÅKER VI! *felåt att jag tjatar xD* jag börjar få lite resfeber... typ ZOMFGROFLLOL. Eller nåt. Nerver. Jag är supertaggad och superspänd och vill bara åka iväg nu fastän jag någonstans vill stanna hemma xD jobbig känsla detdär. Men vi tar hand om varandra och gör så att det blir en wünderbar resa, right? :D <3 jag längtar! ÅÅÅH!

Nu är mina naglar orangea btw. Nu ska jag även fixa lite andra random grejer också som jag egentligen borde gjort för ett par timmar sedan, lol. Kul. Partyparty <3 sen är jag typ fit for fight. Haha.
Jag kommer sakna min familj och alla andra här hemma :( <3 boho :(



HAHAHAHA på sista bilden <3<3<3<3

NU SKA JAG FIXA. TJOHEJ! HARE BÄST <3



Gimmie gimmie gimmie more ladies.

Eskilstuna + sol överallt + mer sol = glad Linnea.
Ann och jag gjorde en hej-vi-går-i-lekis-och-är-bästisar, vi köpte likadana tröjor. Eller, jag köpte likadan tröja som hon. MEN DEN VAR JU SÅ HIMLA SNYGG JU!
Denna låt har jag förövrigt blivit beroende av. Och denna.
.

TAGGA!

NU ÄR DET BARA TYP 8H KVAR!!! :D:D:D:D sen drar vi till GRÄÄÄKLAND :D:D:D:D
Jag har precis packat klart och allt fick plats i microväskan, som förövrigt bara väger typ 11kg om jag vägde rätt... (kan man väga fel? :S) håhåhå. Jag har säkert glömt något... höhö. Håhå. Hähä.
Neeeee men idag for jagbeaann till Etuna och där hittade jag tvo kjolar(typsånadärsvartasomallaharnivet), en från HM och en från Monki. Me nöjd. Sen så köpte jag nya solglasögon till Cissi också, eftersom hennes gick sönder nyss på samma sätt som mina gamla gjorde :O ironiskt... :) Cissi, jag ta med dom och du får dom på bussen :D <3

Nu ska jag sätta mig och måla naglarna. Jag funderar på vilken färg jag ska ha. Någon somrig. Kul. Färgstark. Orange får det bli :) ORANGE SOM MAN BLIR AV BRUN UTAN SOL :D <3 weeeeeei!!! Partyparty!

Det här blir KANSKE sista gången jag bloggar innan resan nu, så jag vill passa på att säga HEJDÅ till alla och JAG ÄLSKAR ER! Ha det så bra i Sweden :D <3 vi ses om en vecka <3


blir så jävla trött

vilken piss dag
1: allmänt sur, har massor av allergi som jag kliar sönder
2: min solglasögon pajar,
3: ser att dom vill att jag ska jobba vecka 18 när jag verkligen sagt att jag inte kan
jävka pitt, orkar det här. denna dag kan vara över nu så det blir måndag! och vi åker
ska bara raka benen, måla tånaglarna och packa ännu mer! yay

konsten att packa för mycket

jag tänker medans jag ser BRODER DANIEL FOREVER på svtPlay, saknar och ser framåt

OM NOM NOM NOM

Jag har tråkigt och borde tvätta håret nu. Yay! Jag glor igenom mitt skumma bildbibliotek och hittar störda bilder.
Jag gillar bilder under. Jag vill vara den.
OM NOM NOM NOM! :D:D:D





Johanna, den nedersta bilden påminner mig så mycket om dig :D <3

NEJ NU SKA JAG TA OCH SKAFFA MIG NÅGONTING ATT GÖRA. TJOSVEJS!



Rhinestone Eyes

I'm a scary gargoyle on a tower
That you made with plastic power
Your rhinestone eyes are like factories far away

When the paralytic dreams that we all seem to keep
Drive on engines till they weep
With future pixels in factories far away

So call the mainland from the beach
Your heart is now washed up in bleach
The waves are rising for this time of year

And nobody knows what to do with the heat
Under sunshine pylons we'll meet
while rain is falling like rhinestones from the sky




Kånken VS Dakine

Hemma från en müsig valborg hos Frida med bästa flickorna :) Vill ni veta mer om den är det bara att gå in på Jennifårs blogg och glo :D det som redan har sagts behöver inte upprepas, plus att hon har massa wünderbara bilder :D <3 hihi

Just nu håller jag på att packa. Fan va mycket jag behöver ha med. Hela min säng är full av kläder, allmänt skit och random viktigt stuff. Jag undrar om allt får plats i min microväska. Maybe.
Men nu är det så att jag har ett dilemma. Ett mycket viktigt sådant dessutom.
Jag rotade runt på vinden och hittade mammas gamla Kånken. Den va jävla fin. Heheh. Mamma brann tydligen för Greenpeace och kvinnors rättigheter. Jaja, till dilemmat:

Ska jag ta med den übergamla kultiga Kånken eller det lite halvt gamla fula miniryggsäcken? ^^



Mycket svårt.

Alla måste rösta xD lol :P

PEACE! SNART DRAR JAG TILL VÄRMEN <3<3<3<3<3


RSS 2.0